Bacteriophage T7 (or the T7 phage) is a bacteriophage, a virus that infects bacteria. It infects most strains of Escherichia coli and relies on these...

initiation of the transcription. The consensus in T7 and related phages is: 5' * 3' T7   TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA...

bacteriophages used in phage display are M13 and fd filamentous phage, though T4, T7, and λ phage have also been used. Phage display was first described...

T7 or T-7 may refer to: Thoracic vertebra 7 Thoracic spinal nerve 7 T7 phage, a virus used in the study of biological systems T7 DNA Helicase, a hexameric...

possesses a gene that is expressed to produce T7 RNA polymerase. (This polymerase originates from the T7 phage, a bacteriophage virus which infects E. coli...

186 phage λ phage Φ6 phage Φ29 phage ΦX174 Bacteriophage φCb5 G4 phage M13 phage MS2 phage (23–28 nm in size) N4 phage P1 phage P2 phage P4 phage R17...

bacteriophages. For example, T7 phages have two operons. The first operon codes for various products, including a special T7 RNA polymerase which can bind...

Teseptimavirus (synonyms T7 phage group, T7-like phages, T7-like viruses, T7likevirus) is a genus of viruses in the order Caudovirales, in the family Autographiviridae...

infectious phage made. Proteases have been evolved to cut different peptides using PACE. In these systems, the desired protease cut site is used to link a T7 RNA...

Filamentous phages retard bacterial growth but, contrasting with the lambda phage and the T7 phage, are not generally lytic. Helper phages are usually...